bio rad c1000tm thermal cycler (Bio-Rad)

Bio-Rad is a verified supplier

Bio-Rad manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Bio-Rad bio rad c1000tm thermal cycler
Bio Rad C1000tm Thermal Cycler, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 494 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c1000tm+thermal+cycler/C1000+Touch+Firmware+Update/10__3390_slash_biom16040522-82-6-10
Average 99 stars, based on 494 article reviews

bio rad c1000tm thermal cycler - by Bioz Stars, 2026-09

99/100 stars

Images

Polymerase Chain Reaction:

Article Title: Biofilm formation, cell hydrophobicity, cytotoxic potential, genetic diversity, resistance to antimicrobials, and toxigenic profile properties among Bacillus cereus groups isolated from kitchen sponges in the Republic of Korea
Article Snippet: Individually, amplification reactions were prepared in a 40-μL mixture containing 20 μL of the AccuPower® HotStart PCR PreMix (Bioneer Co., Ltd.), 13 μL of distilled water, 1 μL of forward and reverse primers, and 5 μL of a template DNA. .. PCR was performed by using the C1000TM thermal cycler (Bio-Rad Laboratories Inc.) with the following cycling conditions; an initial denaturation at 95 °C for 10 min, followed by 35 cycles of a denaturation at 95 °C for 30 s, an annealing at 60 °C for 30 s, and an extension at 72 °C for 30 s. The finished PCR products were resolved by carrying out the agarose gel electrophoresis, in which 3 μL of the amplicon was loaded onto a 2% agarose gel (Bio-Rad® Laboratories Inc., Feldkirchen, Germany) containing 1 μg of the Dyne 100 bp DNA Ladder LoadingSTAR (Dyne Bio Inc., Seoul-si, the Republic of Korea). .. Electrophoresis was run at 100 V for 25 min in 0.5 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\times$$\end{document} × a TAE buffer (Bio-Rad® Laboratories Inc.), and DNA bands were visualized under a UV light using the GelDocTM imaging system (Bio-Rad® Laboratories Inc.) with the GelDocTM Software.

Article Title: Biofilm formation, cell hydrophobicity, cytotoxic potential, genetic diversity, resistance to antimicrobials, and toxigenic profile properties among Bacillus cereus groups isolated from kitchen sponges in the Republic of Korea
Article Snippet: Each reaction (40 μL) was composed of 20 μL of the AccuPower® HotStart PCR PreMix (Bioneer Co., Ltd., Daejeon-si, the Republic of Korea), 13 μL of distilled water, 1 μL of forward (ATGTAAGCTCCTGGGGATTCAC) and reverse (AAGTAAGTGACTGGGGTGAGCG) primers, and 5 μL of a template DNA. .. Then, amplifications were carried out by using the C1000TM thermal cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA) under the following cycling conditions; an initial denaturation at 94 °C for 3 min; 35 cycles consisting of 94 °C for 30 s, 45 °C for 40 s, and 72 °C for 3 min; a final extension at 72 °C for 10 min. As described in the Supplementary Table S1, PCR was employed in this study in order to detect the presence of enterotoxin- and cereulide-producing virulence genes, including hblA, hblC, hblD, nheA, nheB, nheC, bceT, cytK, and ces , among the B . cereus isolates. .. Individually, amplification reactions were prepared in a 40-μL mixture containing 20 μL of the AccuPower® HotStart PCR PreMix (Bioneer Co., Ltd.), 13 μL of distilled water, 1 μL of forward and reverse primers, and 5 μL of a template DNA.

Agarose Gel Electrophoresis:

Amplification:

Article Title: Hyperglycemia impairs the expression of inflammatory mediators in rat intestine: an implication for intestinal inflammation and inflammatory bowel disease
Article Snippet: Quantitative real-time PCR was performed in triplicate for each sample in a final reaction volume of 10 μL using AzuraViewTM GreenFast qPCR Blue Mix LR (AZ-2350, Azura Genomics Inc., Raynham, MA, USA). .. Amplification was conducted on a C1000TM Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA) under the following cycling conditions: initial denaturation at 95 °C for 3 min, followed by 39 cycles of 95 °C for 10 s and 60 °C for 30 s, ending with a melting curve analysis to assess amplification specificity. .. Primers for the genes of interest and the housekeeping gene were obtained from Integrated DNA Technologies (Coralville, IA, USA), with sequences provided in Table .

Article Title: Hyperglycemia alters the gene and protein expression of CDC42 in small and large intestine of Sprague-Dawley rats
Article Snippet: Quantitative real-time PCR (RT-qPCR) was performed in triplicate using AzuraViewTM GreenFast qPCR Blue Mix LR (AZ-2350, Azura Genomics Inc., Raynham, MA, USA) in a 10 μL final reaction volume. .. Amplification was conducted on a C1000TM Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA) under the following cycling conditions: initial denaturation at 95 °C for 3 minutes, followed by 40 cycles of 95 °C for 10 seconds and 60 °C for 30 seconds. ..

Real-time Polymerase Chain Reaction:

Article Title: UV Light Inhibited HRV1b Replication but Reduced Adherens Epithelial Junction and Antiviral Responses via SOCS1 in Human Respiratory Epithelial Cells
Article Snippet: A total of 17 μL of master mix and 3 μL of cDNA for each probe were loaded onto qPCR plates (Bio-Rad Laboratories, Inc. Hercules, CA, USA). .. The qPCR plates were loaded into a C1000TM thermal cycler (BIO-RAD Laboratories, Hercules, CA, USA). .. The DNA was amplified using the BioRad CFX Maestro software version number 2.3, and the protocol was followed (105 °C, 30 min at 94 °C, 30 min at 50 °C, 2 min at 72 °C).

Article Title: UV Light Inhibited HRV1b Replication but Reduced Adherens Epithelial Junction and Antiviral Responses via SOCS1 in Human Respiratory Epithelial Cells.
Article Snippet: A total of 17 μL of master mix and 3 μL of cDNA for each probe were loaded onto qPCR plates (Bio-Rad Laboratories, Inc. Hercules, CA, USA). .. The qPCR plates were loaded into a C1000TM thermal cycler (BIO-RAD Laboratories, Hercules, CA, USA). .. The DNA was amplified using the BioRad CFX Maestro software version number 2.3, and the protocol was followed (105 ◦C, 30 min at 94 ◦C, 30 min at 50 ◦C, 2 min at 72 ◦C).

Review